Skip to main navigation Skip to main content

Clin Mol Hepatol : Clinical and Molecular Hepatology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

USP29 alleviates the progression of MASLD by stabilizing ACSL5 through K48 deubiquitination

Clinical and Molecular Hepatology 2025;31(1):147-165.
Published online: October 2, 2024

1Taikang Medical School (School of Basic Medical Sciences), Wuhan University, Wuhan, China

2Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan, China

3Medical Science Research Center, Zhongnan Hospital of Wuhan University, Wuhan, China

4State Key Laboratory of New Targets Discovery and Drug Development for Major Diseases, Gannan Innovation and Translational Medicine Research Institute, Gannan Medical University, Ganzhou, China

Corresponding author : Peng Zhang Taikang Medical School (School of Basic Medical Sciences), Wuhan University, 115 Donghu Road, Wuchang District, 430000 Wuhan, Hubei Province, China Tel: +86-027-68759222, Fax: +86-027-68759222, E-mail: zhp@whu.edu.cn
Hongliang Li Taikang Medical School (School of Basic Medical Sciences), Wuhan University, 115 Donghu Road, Wuchang District, 430000 Wuhan, Hubei Province, China Tel: +86-027-68759222, Fax: +86-027-68759222, E-mail: lihl@whu.edu.cn

These authors contributed equally to this work.


Editor: Ja Hyun Koo, College of Pharmacy, Seoul National University, Korea

• Received: June 25, 2024   • Revised: September 29, 2024   • Accepted: October 2, 2024

Copyright © 2025 by The Korean Association for the Study of the Liver

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 13,013 Views
  • 747 Download
  • 16 Web of Science
  • 14 Crossref
  • 16 Scopus
prev next
  • Background/Aims
    Metabolic dysfunction–associated steatotic liver disease (MASLD) is a chronic liver disease characterized by hepatic steatosis. Ubiquitin-specific protease 29 (USP29) plays pivotal roles in hepatic ischemia-reperfusion injury and hepatocellular carcinoma, but its role in MASLD remains unexplored. Therefore, the aim of this study was to reveal the effects and underlying mechanisms of USP29 in MASLD progression.
  • Methods
    USP29 expression was assessed in liver samples from MASLD patients and mice. The role and molecular mechanism of USP29 in MASLD were assessed in high-fat diet-fed and high-fat/high-cholesterol diet-fed mice and palmitic acid and oleic acid treated hepatocytes.
  • Results
    USP29 protein levels were significantly reduced in mice and humans with MASLD. Hepatic steatosis, inflammation and fibrosis were significantly exacerbated by USP29 deletion and relieved by USP29 overexpression. Mechanistically, USP29 significantly activated the expression of genes related to fatty acid β-oxidation (FAO) under metabolic stimulation, directly interacted with long-chain acyl-CoA synthase 5 (ACSL5) and repressed ACSL5 degradation by increasing ACSL5 K48-linked deubiquitination. Moreover, the effect of USP29 on hepatocyte lipid accumulation and MASLD was dependent on ACSL5.
  • Conclusions
    USP29 functions as a novel negative regulator of MASLD by stabilizing ACSL5 to promote FAO. The activation of the USP29-ACSL5 axis may represent a potential therapeutic strategy for MASLD.
• USP29 protein levels were significantly reduced in the livers of patients and mice with MASLD.
• USP29 deletion significantly exacerbated hepatic steatosis, inflammatory infiltration, and fibrosis in preclinical MASLD models.
• USP29 markedly repressed ACSL5 degradation by increasing ACSL5 K48-linked deubiquitination to promote FAO under metabolic stimulation.
• Activating USP29-ACSL5 might be a promising therapeutic approach for MASLD.

Graphical Abstract

Metabolic dysfunction–associated steatotic liver disease (MASLD), previously known as nonalcoholic fatty liver disease (NAFLD), represents a spectrum of chronic liver conditions, ranging from metabolic dysfunction-associated steatotic liver (MASL) to more severe metabolic dysfunction-associated steatohepatitis (MASH), which can progress to cirrhosis and even hepatocellular carcinoma (HCC) [1-3]. A comprehensive meta-analysis revealed a global MASLD incidence of 32.4% [4]. MASLD is the leading cause of hepatic failure and transplantation worldwide [5]. MASLD is strongly associated with obesity, metabolic syndrome, and cardiovascular diseases [6-8]. The treatment of MASLD is still focused on improving lifestyle [9]. Although the Food and Drug Administration (FDA) has approved resmetirom for the treatment of individuals with MASLD, it is not likely that a single drug will yield satisfactory treatment efficacy because of the complex mechanisms involved in the development of MASLD [10,11]. Therefore, more promising therapeutic targets for MASLD are urgently needed.
MASLD is caused by excessive lipid accumulation within liver tissue [12]. An imbalance between lipid acquisition through fatty acid uptake or de novo lipogenesis and lipid disposal via fatty acid oxidation (FAO) or excretion causes this accumulation [13]. The lipotoxicity induced by excessive hepatic lipid accumulation is often associated with the promotion of an inflammatory response, which contributes to the pathogenesis of MASLD [14]. Fatty acids taken up into cells are first activated to fatty acyl-CoA by acyl-CoA synthetases and then directed into various metabolic pathways, such as lipid synthesis and fatty acid oxidation [15]. Fatty acid oxidation largely contributes to the disposal of excess hepatic lipids [16]. For example, long-chain acyl-CoA synthase 5 (ACSL5) alleviates MASLD progression by promoting fatty acid oxidation [17]. Increasing the oxidation of fatty acids, thereby preventing their accumulation in the liver, may be an effective strategy for treating individuals with MASLD.
Ubiquitin-specific protease 29 (USP29) is a member of the USP family of deubiquitinases, which play a key role in maintaining protein stability by removing ubiquitin chains from substrates [18]. Human USP29 is located on chromosome 19, is composed of 922 amino acids and contains a typical USP catalytic activity domain [19]. USP29 has been reported to play different regulatory roles in a variety of diseases, including liver disease [20]. For example, USP29 attenuates hepatic ischemia-reperfusion injury by preventing the activation of TAK1 through K63-linked polyubiquitination [21]. USP29 promotes sorafenib resistance in HCC cells by stabilizing HIF1α [22]. However, the underlying effects and mechanisms of USP29 on lipid metabolism and MASLD remain unclear.
Here, we identified USP29 as a significant negative regulator of MASLD progression. USP29 deficiency exacerbated hepatic steatosis, inflammation and fibrosis. However, USP29 overexpression had the opposite effect. Furthermore, USP29 significantly activated the expression of genes related to FAO under metabolic stimulation. Moreover, USP29 directly interacted with ACSL5 and stabilized ACSL5 via K48-linked deubiquitination. Moreover, the effect of USP29 on hepatocyte lipid accumulation and MASLD was dependent on ACSL5. These findings suggest that activating USP29-ACSL5 might be a promising therapeutic approach for MASLD.
Human liver samples
Liver samples were randomly collected from individuals undergoing bariatric surgery. These samples were subjected to H&E staining and independently reviewed by two pathologists using standard histologic criteria to ensure unbiased selection and blinded scoring. Samples with a NAFLD activity score (NAS) of 0 were categorized as non-steatosis, those with a NAS of 1-2 but lacking ballooning or fibrosis were classified as simple steatosis, while those with a NAS of 5 or higher or a NAS of 3-4 accompanied by fibrosis were identified as MASH. All procedures involving the collection of human samples were approved by the Ethics Committee of ZhongNan Hospital of Wuhan University, and written informed consent was obtained from the subjects or their family members in accordance with the principles outlined in the Declaration of Helsinki.
Animal models and animal experiment management
Male C57bL/6J mice, aged 6 weeks, were purchased from Beijing Huafukang Biotechnology and adaptively bred for 2 weeks. To establish a MASLD model, the mice were subjected to a high-fat diet (HFD) feed (MD12032, 45% fat, 20% protein, 35% carbohydrate, Medicience, Nanjing, China) for 24 weeks. To establish a MASH model, the mice were fed a high fat and high cholesterol (HFHC) diet (IMA2019001, 42% fat, 14% protein, 44% carbohydrate, and 2% cholesterol, Trophic Diet, Nantong, China) for 16 weeks. The control group was fed a normal diet (1010086, 10% fat, 18% protein, and 72% carbohydrate, xietong, Nanjing, China) for the same duration. Another MASH model was established by feeding a methacholine-deficient diet (MCD, TP3005G, trophic diet, Nantong, China) diet for 4 weeks, while a methacholine-supplemented diet (MCS, TP3005GS, trophic diet, Nantong, China) diet was used as the control.
All mice were housed in the SPF animal room of the Animal Center, Institute of Cardiovascular Disease, Renmin Hospital of Wuhan University. The room temperature was maintained at 23±2℃, with a 12-hour day-night cycle, and water was freely available. All mouse experimental protocols were approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University and conformed to the relevant ethical guidelines.
Generation of genetically modified mice
USP29-KO mice were generated using the cas9 system. Initially, the CRISPR online design tools (http://chopchop.cbu.uib.no/) were used to predict the target gene DNA regions for the USP29 startup sequence of guideRNA target site (sgRNA1 TGATAATGTTACAGGCGTAGTGG and sgRNA2 AGTGGTATTCAGGGATCCACAGG). The in vitro transcripts of sgRNA expression vector and another expression vector were purified, mixed, and injected into single-cell fertilized eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. The fertilized eggs were then implanted into female mice acting as surrogates in order to generate F0 generation mice. PCR-positive mice were bred to generate USP29-KO mice, while littermate negative mice served as control animals. The primers were identified as primer-F (5’-3’)-TGGCTCACCTAAAGATAAATGG and primer-R (5’-3’)-TCACAGCTTTCTC TGCTTTG. To over-expression USP29 or ACSL 5, the 2*1011vg AAV8 in 100mL phosphate buffered saline (PBS) was injected via tail vein to Wide type mice or USP29-KO mice, the vector as a control.
Glucose tolerance (GTT) and insulin tolerance (ITT) tests
To determine GTT and ITT, mice were subjected to a 6-hour fasting period without access to water. Blood glucose levels were measured using a glucometer. Then intraperitoneal injections of glucose (1 g/kg) and insulin (0.75 IU/kg) were administered, respectively, and blood glucose levels were measured at 15 minutes, 30 minutes, 60 minutes, and 120 minutes post-injection.
Measurement of serum biochemistry and triglyceride content
Serum lipids including triglyceride, total cholesterol and low-density cholesterol, as well as liver function tests such as ALT and AST were detected by serum biochemical analyzer (HITACHI3110, Japan). The liver and cell triglycerides content were measured according to the instructions of the kit (A110-1-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
Histopathological analysis
Liver tissues were fixed in 10% formalin, dehydrated, embedded in paraffin, and cut into 5μm sections. Hematoxylin and eosin (H&E, Hematoxylin, G1004, Servicebio, Wuhan, China; Eosin, BA-4024, Baso, Zhuhai, China) staining was performed using a multi-function dyeing machine (ST5020-CV5030; Leica, Wetzler, Germany). The sections were dewaxed and hydrated before being stained with Sirius red staining (PSR) (26357-02; Hedebiotechnology, Beijing, China). Additionally, frozen liver tissue slices were also cut into 5 microns using a multi-function dyeing machine for oil red O staining (O0625; Sigma, St. Louis, MO, USA). For immunohistochemical analysis, the sections were subjected to antigen retrieval using EDTA. Endogenous catalase was inactivated with 3% H2O2, and then blocked with a 10% BSA (NA8692; Bomei Biotechnology, Hefei, China) solution at 37°C for 60 minutes. The primary antibody (USP29, 27522-1-AP, 1:100 dilution, Proteintech, Wuhan, China; ACSL5, A14130, 1:100 dilution, ABclonal, Wuhan, China; CD11B, BM3925, 1:4000 dilution, Boster, Wuhan, China) was added and incubated overnight at 4°C. Subsequently, the corresponding secondary antibody (PV-9001; ZSGB-BIO, Beijing, China) was incubated at 37°C for 30 minutes, followed by color development of immunohistochemistry using a DAB Color kit (BLRE079-200T; Biolight, China) according to the manufacturer’s instructions. Finally, the images were obtained either through a digital pathology scanner (Win180, WINMEDIC, Jinan, China) or microscopy (ECLIPSE 80i; Nikon, Tokyo, Japan).
Immunofluorescence analysis
For tissue immunofluorescence staining analysis, the sections were subjected to EDTA antigen retrieval and blocked with 10% BSA for 30 minutes at 37°C. The primary antibody (F4/80, GB11027, 1:1600 dilution, Servicebio, Wuhan, China; a-sma: ab5694, 1:200 dilution, abcam, Cambridge, UK) was added and incubated overnight at 4°C. Subsequently, the corresponding secondary antibodies were incubated at 37°C for 60 minutes. After sealing with slow fade gold anti-fade reagent containing DAPI (BMU107-CN; Abbkine, Wuhan, China), images were captured using a tissue cytometer analysis system (TissueFAXS Spectra, TissueGnostics, Austria) in a darkroom.
For cell immunofluorescence staining analysis, cells were fixed using 4% paraformaldehyde, permeabilized with 0.2% Triton for 10 minutes to enhance cell membrane permeability, and subsequently blocked with 10% BSA at 37°C for 60 minutes. The primary antibody (USP29, A16564, 1:100 dilution, ABclonal, Wuhan, China) was added and incubated overnight at 4°C. The corresponding secondary antibody was then incubated at 37°C for an additional 60 minutes, followed by nuclei staining with DAPI. Finally, the images were captured using a confocal laser scanning microscope (TCSSP8; Leica).
Primary cell isolation and culture
Primary cells were isolated from 6-8-week-old male C57BL/6J mice. After anesthetized, the mice were perfused with a sequential infusion of liver perfusion medium (17701-038; Thermo Fisher Scientific, Waltham, MA, USA) and liver digestion medium (17701-034; Thermo Fisher Scientific) via the portal vein. The well-digested liver tissue was collected into DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin, followed by filtration through a 70 μm cell strainer. Finally, after centrifugation at 50 g, the primary hepatocytes were obtained by resuspending the precipitate in DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. At the same time, primary Kupffer cells and sinus endothelial cells were obtained from the supernatant by gradient centrifugation. All cells were cultured at 37℃ in an incubator containing 5% CO2.
Nile red staining
Primary hepatocyte cells were fixed with 4% paraformaldehyde solution, followed by staining with Nile red for lipid and DAPI for nuclear staining. The images were captured using a confocal laser scanning microscope (TCSSP8; Leica).
Western blot
Liver tissues and cells were effectively lysed using RIPA lysis buffer (65 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate and 0.1% SDS) supplemented with protease inhibitor (04693132001; Roche, Basel, BS, Switzerland) and phosphatase inhibitor (4906837001; Roche). Total protein was obtained from the supernatant by centrifugation at 12,000 rpm for 15 to 30 min at 4℃, and the concentration was determined using the BCA Protein Assay Kit (23225; Thermo, Waltham, MA, USA). The protein separation was performed using a 10% SDS-PAGE, followed by transfer onto a PVDF membranes (IPVH00010; Millipore, Billerica, MA, USA) and blocking with 5% skim milk in TBST. The PVDF membranes were incubated with the target primary antibody overnight at 4°C, followed by incubation with the appropriate HRP-conjugated secondary antibody for 1 hour at room temperature. Finally, the ECL kit (170-5061; Bio-Rad, Hercules, CA, USA) and the ChemiDoc MP imaging system (Bio-Rad) were utilized for image acquisition and quantitative analysis. The antibodies utilized are detailed in Supplementary Table 1.
Real-time fluorescence quantitative PCR (qPCR)
Total tissue and cells RNA was extracted using TRIzol reagent (T9424; Sigma, St. Louis, Missouri, USA). The first strand cDNA was synthesized according to the instructions of reverse transcription kit (R323-01; Vazyme, Nanjing, China).The qPCR analysis was performed using SYBR Green (Q111-02; Vazyme) on the LightCycler 480 system (Roche). The housekeeping gene β-Actin was used to quantify the relative expression levels of genes. Primer sequences used were shown in Supplementary Table 2.
Plasmid construction and adenovirus packaging
The full-length, truncated, and mutant USP29 and ACSL5 were amplified by PCR. Subsequently, the proper sequences were subcloned into the corresponding vectors to construct overexpression plasmids.
The full-length sequences of USP29 and ACSL5, as well as the shRNA sequence of ACSL5, were initially inserted into the shuttle vector pENTR-CMV. Subsequently, the target gene was recombined into the adenovirus vector pAd/PL-DEST to obtain the corresponding recombinant adenovirus plasmids. The recombinant adenovirus plasmids were transfected into 293A cells using the transfection reagent PEI Max in order to obtain the corresponding viruses. Subsequently, purification of the recombinant adenovirus was performed and its titer was determined using the plaque forming unit (PFU) method. Primers for plasmid construction were listed in Supplementary Table 3.
RNA-Seq analysis
The total RNA extracted was utilized for the construction of a cDNA library, which was subsequently sequenced on MGISEQ2000. Quality analysis of the original data sequence was performed with HISAT2, comparing and commenting with the mm10. Fasta and Mus_musculus. GRCm38.89. Protein coding. GTF databases. SAMtools and String Tie software were employed for data transformation and expression calculation, while DESeq2 was used for normalization and differential expression analysis.
Immunoprecipitation assays
The 293T cells transfected with the corresponding expression plasmids or primary hepatocytes infected with the corresponding virus were lysed with IP lysis buffer (20 mM Tris-HCl, pH 7.4; 150 mM NaCl; 1 mM EDTA; and 1% NP-40) containing cocktail. After centrifugation, the supernatant was retained. One portion of the supernatant was used as input quality control for WB analysis, and the other portion was incubated with beads washed by IP buffer and the indicated Agarose-anti-tag antibody beads overnight at 4°C. For endogenous IP, cells were immunoprecipitated with the indicated primary antibody. SDS loading was added and the mixture was mixed by centrifugation after denaturation at 95°C for 10 min. The beads were subjected to a NaCl wash followed by SDS loading, and subsequently denatured at 95°C for 10 minutes prior to analysis via Western blot.
GST-pull down assays
GST-HA-USP29, GST-HA-ACSL5, Flag-ACSL5 and Flag-USP29 were overexpressed in 293T cells for 24 h and lysed in a Lysis buffer (50mM Na2HPO4, pH 8.0; 300mM NaCl; 1% TritonX-100; cocktail). GST-HA-proteins were purified by GST beads, and Flag-proteins were de-hybridized with GST beads. Then the Flag-related supernatants were mixed with GST beads and incubated overnight. The beads were washed for 3 times with the buffer solution (20mM Tris-HCl, PH 6.8; 150mM NaCl; 0.2% TritonX-100). Finally, the proteins were detected by WB after boiling at 95°C for 5–10 min.
Immunoprecipitation-Mass spectrometry analysis
Primary hepatocytes were infected with USP29 overexpression adenovirus and control virus (GFP) and collected 12h after PAOA treatment. The cells were then immunoprecipitated using flag and separated by SDS-page, followed by silver staining. The adhesive strips were cut into small pieces for mass spectrometry analysis on the mass spectrometer (Orbitrap Eclipse Tribrid mass spectrometer, Thermo Fisher). The data obtained from mass spectrometry were analyzed using MaxQuant1.6.0.1 software.
In vivo ubiquitination assay
transfected cells were lysed in SDS lysis buffer (20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA and 1% SDS) and denatured by heating at 95°C. The samples were then diluted 10-fold with IP buffer and immunoprecipitated with the indicated antibodies. The anti-Myc, anti-ubiquitin, anti-K48-linked ubiquitin chains antibodies were used to analyze the ubiquitination of the immunoprecipitants.
Statistical analysis
All data were presented as the mean±SD using Prizm8.0 software. Statistical analysis was performed using SPSS software. When the data followed a normal distribution, a two-tailed Student’s t-test was employed to compare the data between two groups, while one-way ANOVA was utilized to compare the data among three or more groups. For ANOVA analysis, Bonferroni’s post hoc test was employed for assessing homogeneous data variances, while Tamhane’s T2 (M) post hoc test was utilized for evaluating heterogeneous data variances. The data that deviated from the normal distribution were subjected to analysis using nonparametric statistical tests.
USP29 expression is downregulated in the pathogenesis of MASLD
To investigate the potential role of USP29 in MASLD, we initially examined the expression of USP29 in the livers of MASLD model mice. The results revealed a significantly lower USP29 protein level in the livers of mice fed a high-fat diet (HFD) for 24 weeks than in those of mice fed normal chow (NC). Interestingly, the mRNA level of USP29 was not significantly different between the groups (Fig. 1A). Similar results were also found in the livers of mice fed a high-fat high-cholesterol (HFHC) diet or a methionine- and choline-deficient (MCD) diet (Fig. 1B, (C). Consistent with the results in mice, the protein level of USP29 in the livers of humans with MASLD was significantly lower than that in the livers of humans without MASLD (Fig. 1D). Furthermore, immunohistochemical staining analysis revealed a decrease in USP29 expression in hepatocytes (Fig. 1E), which was confirmed by the finding that the protein level of USP29 was markedly reduced in primary hepatocytes (Fig. 1F, Supplementary Fig. 1A) but not in sinusoidal endothelial cells or Kupffer cells following treatment with palmitic acid and oleic acid (PAOA) or lipopolysaccharide (LPS) (Supplementary Fig. 1B). Collectively, these data suggest that USP29 may participate in the pathogenesis of MASLD.
USP29 deletion exacerbates insulin resistance and hepatic steatosis induced by a HFD
To explore the potential role of USP29 in hepatic steatosis in MASLD, USP29 knockout (USP29-KO) mice were generated and fed a HFD for 24 weeks (Supplementary Fig. 2A). After 24 weeks of HFD feeding, compared with those of wild-type (WT) mice, the body weights and blood glucose levels of USP29-KO mice were significantly greater (Fig. 2A, B). Glucose tolerance and insulin sensitivity were also markedly impaired in USP29-KO mice (Fig. 2C, (D). Moreover, USP29-KO mice presented increases in liver weight, the liver weight-to-body weight ratio, white adipose weight, and the white adipose weight-to-body weight ratio (Fig. 2E, Supplementary Fig. 2C). Compared with WT mice, USP29-KO mice presented significantly elevated liver triglyceride (TG) and serum lipid contents, including TG, total cholesterol (TC) and low-density lipoprotein cholesterol (Fig. 2F, G). H&E and Oil Red O staining confirmed the increased severity of hepatic steatosis in HFD-fed USP29-KO mice (Fig. 2H). Moreover, the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were significantly increased in USP29-KO mice (Supplementary Fig. 2D). However, USP29-KO did not affect baseline metabolic characteristics. These results demonstrate that USP29 deletion exacerbates insulin resistance and hepatic steatosis induced by a HFD.
USP29 knockout accelerates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet
We further assessed the role of USP29 in MASH model mice induced by a HFHC diet, which exhibited a more obvious inflammatory response and fibrosis than did mice fed a HFD [23]. Consistent with the results for HFD-fed mice, after 16 weeks of HFHC diet feeding, compared with WT mice, USP29-KO mice presented significant increases in body weight and blood glucose and impaired glucose tolerance (Fig. 3A, B and Supplementary Fig. 3A). After 16 weeks of HFHC diet feeding, compared with WT mice, USP29-KO mice presented greater liver weights, liver weight-to-body weight ratios, white adipose weights, and white adipose weight-to-body weight ratios (Fig. 3C and Supplementary Fig. 3B, C). Moreover, after 16 weeks of HFHC diet feeding, USP29-KO mice presented more pronounced hepatic steatosis than did WT mice (Fig. 3DF). Notably, compared with WT mice, USP29-KO mice presented increased inflammatory cell infiltration and more severe collagen deposition (Fig. 3G). Similarly, the serum ALT and AST levels were also significantly elevated in USP29-KO mice (Supplementary Fig. 3D). In conclusion, these results indicate that USP29 knockout accelerates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet.
USP29 overexpression alleviates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet
To further confirm the effect of USP29 overexpression on HFHC diet-induced MASH in mice, we overexpressed USP29 by injecting AAV8-USP29, in parallel with a control, into C57BL/6J mice (Supplementary Fig. 4A). After being fed a HFHC diet, the USP29-overexpressing mice presented lower body weights and blood glucose levels than those of the controls (Supplementary Fig. 4B, C). Glucose tolerance was also improved by USP29 overexpression (Supplementary Fig. 4D, E). Moreover, the liver weights, white adipose weights, and ratio of liver weights or white adipose weights to body weights in USP29-overexpressing mice were markedly lower than those in controls (Supplementary Fig. 4F, G). Intriguingly, USP29 overexpression obviously attenuated hepatic steatosis, inflammation, collagen deposition and liver injury (Supplementary Fig. 4HK). Together, these data suggest that USP29 overexpression ameliorates HFHC-induced MASH in mice.
USP29 alleviates hepatocyte lipid deposition and inflammation and promotes the fatty acid degradation pathway
Hepatocytes, the most important parenchymal cells in the liver, play a major role in a variety of liver diseases [24]. To further elucidate whether USP29 plays a key role in lipid deposition and inflammation in hepatocytes, mouse primary hepatocytes were isolated from USP29-KO mice and WT mice (Supplementary Fig. 5A). Nile red staining and triglyceride content analysis demonstrated that USP29 KO enhanced lipid deposition in cells stimulated with PAOA (Fig. 4A, B). Furthermore, we overexpressed USP29 in hepatocytes via infection with an adenovirus overexpressing USP29 (AdUSP29), with AdGFP used as a control (Supplementary Fig. 5B). Lipid accumulation was significantly lower in hepatocytes infected with AdUSP29 than in hepatocytes infected with AdGFP after treatment with PAOA (Fig. 4C, D).
To elucidate how USP29 regulates lipid metabolism in hepatocytes, RNA-Seq analysis was performed. GSEA was used to analyze the pathways that were reversely regulated due to abnormal USP29 expression. A Venn diagram revealed that 16 pathways were inhibited by USP29-KO but promoted by USP29 overexpression. Additionally, the fatty acid degradation pathway was most significantly enriched according to robust rank aggregation (Fig. 4E). In addition, we found that pathways related to inflammation were activated by USP29-KO but inhibited by USP29 overexpression (Fig. 4F). Representative genes related to fatty acid β-oxidation, such as carnitine palmitoyl transferase 1A (Cpt1a) and enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase (Ehhadh), and inflammation genes, such as C-C motif chemokine ligand 5 (Ccl5) and C-X-C motif chemokine ligand 2 (Cxcl2), were significantly affected by USP29 overexpression or knockout (Supplementary Fig. 5C, D). These results suggest that USP29 significantly alleviates PAOA-induced lipid accumulation and inflammation in hepatocytes and promotes the fatty acid degradation pathway.
USP29 interacts with ACSL5 and upregulates ACSL5 expression
To investigate the mechanism of USP29 in fatty acid degradation, co-immunoprecipitation mass spectrometry was performed to identify proteins that interact with USP29. Among more than 10 unique peptides in the USP29 overexpression group, three proteins associated with fatty acid degradation—aldehyde dehydrogenase 2 family member (ALDH2), acyl-CoA oxidase 1 (ACOX1) and long-chain acyl-CoA synthetase 5 (ACSL5)—were identified (Fig. 5A). The interaction between these three proteins and USP29 was confirmed by co-immunoprecipitation (co-IP) (Fig. 5B). However, western blot analysis revealed that only the ACSL5 protein level was significantly increased in hepatocytes infected with AdUSP29 under PAOA treatment (Fig. 5C).
ACSL5 is a key enzyme involved in fatty acid activation and has been reported to inhibit MASLD progression by promoting FAO [17]. Next, to test whether USP29 modulates MASLD via ACSL5, the effects of USP29 on ACSL5 were assessed. ACSL5 protein levels increased in a gradient-dependent manner with the overexpression of USP29 in PAOA-treated hepatocytes (Fig. 5D). In contrast, USP29 deficiency significantly reduced ACSL5 protein levels in both PAOA-treated hepatocytes and the livers of HFHC diet-fed mice (Fig. 5E, F). Furthermore, ACSL5 protein levels were noticeably lower in liver samples from humans with MASLD and in PAOA-treated hepatocytes than in the respective controls (Fig. 5GI). Taken together, these results suggest that USP29 markedly upregulates ACSL5 expression.
The effect of USP29 on hepatocyte lipid accumulation and MASLD is dependent on ACSL5
To investigate whether the impact of USP29 on lipid accumulation in hepatocytes is dependent on ACSL5, we overexpressed ACSL5 in hepatocytes isolated from USP29-KO mice (Fig. 6A). Intriguingly, the overexpression of ACSL5 reversed the aggravated effects of USP29 knockout on lipid deposition in hepatocytes treated with PAOA (Fig. 6B, C). The expression of FAO-related (Cpt1a and Ehhadh) and inflammation-related (Cxcl2 and Ccl5) genes induced by USP29 knockout was significantly reversed by ACSL5 overexpression (Fig. 6D). Notably, ACSL5 knockdown markedly reversed the inhibitory effect of USP29 overexpression on hepatocytes treated with PAOA (Supplementary Fig. 6AD).
To determine whether ACSL5 overexpression also reversed the role of USP29 knockout in MASLD in vivo, ACSL5 was overexpressed in USP29-KO mice by injecting AAV8-ACSL5 (Supplementary Fig. 7A). ACSL5 overexpression significantly attenuated the increased body weight, blood glucose and glucose tolerance induced by USP29 deletion (Supplementary Fig. 7BD). Moreover, ACSL5 overexpression significantly reversed the increases in liver weights, the liver weight-to-body weight ratios and the levels of serum lipids in USP29-KO mice (Fig. 6E, F). Similarly, the increased white adipose weights, white adipose weight-to-body weight ratios and serum ALT and AST levels induced by USP29 deletion were also reversed by ACSL5 overexpression (Supplementary Fig. 7E, F). Intrigu-ingly, ACSL5 overexpression abolished the more severe hepatic steatosis, inflammation and collagen deposition induced by USP29 KO (Fig. 6G). Collectively, these results suggest that the effect of USP29 on MASLD is dependent on ACSL5.
USP29 directly interacts with ACSL5 and stabilizes ACSL5 through the suppression of K48-linked ubiquitination.
Next, we investigated the mechanism by which USP29 regulates ACSL5. First, the interaction between USP29 and ACSL5 was further confirmed by co-IP (Fig. 7A, B). Additionally, a GST pull-down assay revealed a direct interaction between USP29 and ACSL5 (Fig. 7C, D). Domain mapping analysis revealed that the USP domain of USP29 (aa 284–922) and the active region of ACSL5 (aa 1–571) mediate this interaction (Fig. 7E, F).
Furthermore, in the presence of the protein synthesis inhibitor cycloheximide (CHX), USP29 clearly extended the half-life of ACSL5 (Fig. 8A). Notably, the ubiquitination of ACSL5 was significantly decreased after USP29 overexpression but increased after USP29 KO (Fig. 8B, C). A screening assay for potential types of lysine ubiquitination revealed that USP29 significantly suppressed the K48-linked ubiquitination of ACSL5 (Fig. 8D). Consistently, we found that USP29 KO promoted the K48-linked ubiquitination of ACSL5 (Fig. 8E). Interestingly, compared with wildtype USP29, mutated USP29 (C298A) did not effectively inhibit the degradation of ACSL5 or hepatocyte lipid deposition (Fig. 8FI). Taken together, these data suggest that USP29 stabilizes ACSL5 through the suppression of K48 ubiquitination, which is dependent on the USP domain of USP29.
The present study revealed a novel role of USP29 in MASLD. Specifically, diet-induced hepatic steatosis, inflammation and fibrosis were significantly exacerbated by USP29 deletion and relieved by USP29 overexpression. USP29 can protect itself from degradation through self-deubiquitination, which is dependent on its N-terminal region [25]. Our study demonstrated that the protein level, rather than the mRNA level, of USP29 was significantly decreased in mice and humans with MASLD. Therefore, we speculate that a pivotal molecule binds to the N-terminus of USP29 to impede its self-deubiquitination under the pathological conditions associated with MASLD, which needs to be tested in future studies.
Extensive research indicates that the downregulation of fatty acid oxidation is correlated with increased MASLD severity [12,26]. In the present study, we found that USP29 significantly activated the expression of genes involved in FAO, such as Cpt1a and Ehhadh. Furthermore, we found that USP29 directly interacted with ACSL5 and upregulated ACSL5 expression. Moreover, the overexpression of ACSL5 reversed the effect of USP29 KO on MASLD and the expression of genes involved in FAO. These data suggest that USP29 mediated MASLD by stabilizing ACSL5 and further activating FAO. The fatty acid oxidation process is complex and involves multiple key enzymes and transcription factors [27,28]. As a rate-limiting enzyme in the initial stage of fatty acid oxidation, ACSLs activate long-chain fatty acids to produce acyl-CoAs, which are directed to the mitochondria for β-oxidation [29]. It has been shown that the activation of ACSL5 ameliorates MASLD by increasing fatty acid β-oxidation [17,30,31]. Peroxisome proliferator-activated receptor α (PPARα) is a core transcription factor that mainly regulates key enzymes involved in FAO. The transcriptional activity of PPARα is regulated by its ligands, such as fatty acids and metabolites produced from the fatty acid metabolic pathway [32,33]. Together, in the present study, the regulatory effect of USP29-ACSL5 on the expression of genes involved in FAO may have occurred because, under metabolic stimulation, USP29 stabilized ACSL5 expression to promote the activation of fatty acids, which in turn activated PPARa to induce the expression of genes involved in FAO and then directed them to the mitochondria for β-oxidation. This needs to be further demonstrated in future studies.
The expression of ACSL5 is regulated at the transcriptional level by a variety of metabolic factors, such as SREBP-1C and HNF4 [34,35]. Our study revealed that the expression of ACSL5 was also regulated through ubiquitination. These findings provide a novel potential strategy for stabilizing ACSL5 in the liver as a viable approach to prevent MASLD.
USPs constitute the largest family of deubiquitinating enzymes and play a key role in maintaining protein homeostasis and disease [36,37]. As a typical USP, the deubiquitinating enzymatic activity of USP29 is dependent on the integrity of its C-terminal USP domain [22,38-40]. Consistent with these findings, our results revealed that the effect of USP29 on hepatocyte lipid deposition is dependent on its USP domain.
The pathogenesis of MASLD involves multiple cell types, with hepatocytes assuming a pivotal role as the principal constituents within hepatic tissue [41]. In the present study, the USP29 protein level was decreased in hepatocytes, and deletion of USP29 significantly aggravated lipid accumulation in hepatocytes and hepatic steatosis under metabolic stimulation. Moreover, AAV8-mediated USP29 expression effectively alleviated MASLD progression. These findings suggest that the regulation of MASLD by USP29 was mediated through hepatocytes. However, whether USP29 can also affect MASLD by regulating other cells needs to be further investigated.
In conclusion, we identified USP29 as a novel negative regulator of MASLD progression. More importantly, our results suggest novel mechanisms by which USP29 alleviates MASLD by stabilizing ACSL5 and further activating FAO. Thus, targeting USP29-ACSL5 may constitute an effective therapeutic strategy for MASLD.
Part of the present study was presented orally in the 17th Annual Meeting on Lipids and LipoProteins, Xi ‘an, China, May 31-June 2, 2024.
This work was supported by grants from the National Science Foundation of China (81970011 to P.Z, 82170595 to X.J.Z), the basic Medicine-Clinical Medicine Transformation Collaborative Fund of Zhongnan Hospital of Wuhan University (ZNLH202211 to P.Z, ZNLH202204 to X.J.Z), Henan Charity Federation Hepatobiliary Fund (GDXZ2020006 to Y.X.J; GDXZ2023012 to J.Q.Z; GDXZ2020008 to J.J.Q), the Hubei Province Innovation Platform Construction Project (40920204201117303072238 to H.L.L) and Hubei Provincial Engineering Research Center of Model Animal.
Thanks to my friend Huang Yongping for the help of bioinformatics analysis.

Authors’ contribution

HLL and PZ conceived the project and designed most of the experiments. SH, ZXW and KZ performed most of the experimental work. HJS contributed to molecular experiments. FQ contributed to mice primary cells. TZ contributed to histopathological experiments. ST contributed to animal experiments. YXJ, JQZ, ZGS, XJZ and JJQ helped with the design of some experiments. PZ and SH wrote the manuscript. HLL and PZ are the guarantors of this work and, as such, had full access to all the data in the study and took responsibility for the data’s integrity and the data analysis’s accuracy.

Conflicts of Interest

The authors have no conflicts to disclose.

Supplementary material is available at Clinical and Molecular Hepatology website (http://www.e-cmh.org).
Supplementary Figure 1.
USP29 expression is downregulated in the hepatocytes induced by PAOA. (A) Representative immunofluorescence staining to evaluate USP29 expression in mouse primary hepatocytes induced by bSA or PAOA (0.5/1.0 mM) for 12 h. Scale bar, 50 μm; (b) The protein level of USP29 in mouse primary endothelium cells (left) induced by PAOA for 12 h and kupffer cells (right) treated with LPS for 12 h. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (n.s., not significant). PAOA, palmitic acid and oleic acid; bSA, bovine serum albumin; LPS, lipopolysaccharide.
cmh-2024-0478-Supplementary-Figure-1.pdf
Supplementary Figure 2.
USP29 deletion exacerbates white adipose weight and serum ALT and AST level induced by HFD. (A) USP29 protein levels in WT mice and USP29-KO mice (n=3 mice/group). (b) blood glucose of WT mice and USP29-KO mice after NC chow or HFD diet treatment for indicated times (n=9–10 mice/group). (C) White adipose weight and the ratio of white adipose weight to body weight of WT mice and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=9–10 mice/group). (D) Serum AST and ALT content were detected in WT mice and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=9–10 mice/group). The data are presented as mean±SD, *indicates a statistical analysis between WT-NC group and WT-HFD group (*P<0.05, **P<0.01, n.s., not significant). #indicates a statistical analysis between WT-HFD group and USP29-KO-HFD group (*P<0.05, ##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; NC, normal chow; HFD, high fat; ALT, alanine aminotransferase; AST, aspartate aminotransferase.
cmh-2024-0478-Supplementary-Figure-2.pdf
Supplementary Figure 3.
USP29 knockout accelerates body weight, liver weight and white adipose weight and serum level of ALT and AST in mice induced by HFHC. (A) body weight of WT mice and USP29-KO mice after NC chow or HFHC diet treatment for indicated times (n=8–10 mice/group). (b) Liver weight and (C) White adipose weight and the ratio of white adipose weight to body weight of WT mice and USP29-KO mice fed NC chow or HFD diet for 16 weeks (n=8–10 mice/group). (D) Serum ALT and AST content were detected in WT mice and USP29-KO mice fed NC chow or HFHC diet for 16 weeks (n=8–10 mice/group). The data are presented as mean±SD, *indicates a statistical analysis between WT-NC group and WT-HFHC group (**P<0.01, n.s., not significant). #indicates a statistical analysis between WT-HFHC group and USP29-KO-HFHC group (#P<0.05, ##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; NC, normal chow; HFHC, high-fat high cholesterol; ALT, alanine aminotransferase; AST, aspartate aminotransferase.
cmh-2024-0478-Supplementary-Figure-3.pdf
Supplementary Figure 4.
USP29 overexpression alleviates hepatic steatosis, inflammation, and fibrosis induced by a HFHC diet. (A) Schematic of the HFHC-induced MASLD model in WT mice injected with AAV8-USP29 and controls (up), and the representative western blot analysis of Flag-USP29 expression levels in the livers of indicated mice (down). (b) body weight and (C) blood glucose of mice mediated by AAV8-control and USP29 after HFHC diet treatment for 16 weeks (n=8 mice/group). (D, E) GTTs were analyzed in mice injected with AAV8-USP29 and controls fed a HFHC diet for 15weeks (n=8 mice/group). (F) The liver weight and the ratio of liver weight to body weight and (G) white adipose weight and the ratio of white adipose weight to body weight of indicated mice described in (A) (n=8 mice/group). (H) The serum lipid contents including TG, TC and LDL-C and (I) the serum enzymes such as ALT and AST were detected in indicated mice described in (A) (n=8 mice/group). (J) Representative images and relative quantitative statistical analysis of H&E, Oil red O staining of liver tissue from indicated mice described in (A) (n=6 mice/group). Scale bar, 50 μm. (K) Representative images and relative quantitative statistical analysis of CD11b and PSR staining of liver tissue from indicated mice described in (A) (n=4–6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD, *P<0.05, **P<0.01, n.s., not significant. AAV, adeno-associated virus, HFHC, high-fat high cholesterol; GTT, glucose tolerance test; TG, total triglyceride; TC, total cholesterol; LDL-C, low density lipoprotein cholesterol; H&E, hematoxylin and eosin; PSR, picro sirius red. ALT, alanine aminotransferase; AST, aspartate aminotransferase.
cmh-2024-0478-Supplementary-Figure-4.pdf
Supplementary Figure 5.
USP29 alleviates the expression of genes related to fatty acid β oxidation and inflammation. (A) USP29 protein levels in primary hepatocytes isolated from WT mice and USP29-KO mice (n=3 mice/group). (b) USP29 protein expression in primary hepatocytes infected with USP29 overexpression (AdUSP29) and control (AdGFP) adenovirus (n=3 independent experiments). (C, D) The mRNA level of genes related to fatty acid β oxidation and inflammation in USP29-KO and USP29 overexpression hepatocytes induced by PAOA were analysed through RNA-seq and qPCR. The protein and mRNA expression was normalized to β-Actin. The data are presented as mean±SD (**P<0.01, n.s., not significant). bSA, bovine serum albumin; PAOA, palmitate acid and oleic acid; WT, wild type; KO, USP29 knock out; OE, over-expression.
cmh-2024-0478-Supplementary-Figure-5.pdf
Supplementary Figure 6.
ACSL5 knockdown blocked the effect of USP29 on hepatocytes induced by PAOA. (A) The protein expression of USP29 and ACSL5 in WT or USP29-KO primary hepatocytes infected with ACSL5 overexpression and control adenovirus after PAOA stimulation. (b) Representative images of Nile red staining and (C) cellular TG content in indicated primary hepatocytes induced by PAOA (n=3 independent experiments). Scale bar, 25 μm. (D) The mRNA levels of Cpt1a, Ehhadh, Cxcl2 and Ccl5 in indicated primary hepatocytes induced by PAOA (n=4 mice/group). (D) The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (*P<0.05, **P<0.01, n.s., not significant). PAOA, palmitate acid and oleic acid.
cmh-2024-0478-Supplementary-Figure-6.pdf
Supplementary Figure 7.
ACSL5 overexpression blocked the effect of USP29-KO on mice induced by HFHC. (A) Schematic of the HFHC-induced MASLD model in USP29-KO and WT mice injected with AAV8-ACSL5 and controls (left), and the representative western blot analysis of Flag-ACSL5 and USP29 expression levels in the livers of indicated mice (right). (b) body weight and (C) blood glucose of indicated mice described in (A) (n=9 mice/group). (D) The glucose tolerance was measured in indicated mice one week before the sacrifice (n=9 mice/group). (E) White adipose weight and the ratio of white adipose weight to body weight and (F) serum enzymes including ALT and AST in indicated mice described in (A) (n=9 mice/group). The data are presented as mean±SD, *indicates a statistical analysis between WT-AAV8-controls group and KO-AAV8-controls group (*P<0.05, **P<0.01, n.s., not significant). *indicates a statistical analysis #between KO-AAV8-controls group and KO-AAV8-ACSL5 group (##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; ##HFHC, high fat and high cholesterol; GTT, glucose tolerance test; ALT, alanine aminotransferase; AST, aspartate aminotransferase.
cmh-2024-0478-Supplementary-Figure-7.pdf
Supplementary Table 1.
Antibodies list
cmh-2024-0478-Supplementary-Table-1.pdf
Supplementary Table 2.
qPCR primers of human and mouse list
cmh-2024-0478-Supplementary-Table-2.pdf
Supplementary Table 3.
Primers of plasmid construction
cmh-2024-0478-Supplementary-Table-3.pdf
Figure 1.
USP29 expression is down-regulated in the pathogenesis of MASLD. (A) The protein level and relative mRNA level of USP29 in liver tissues of mice fed with NC or HFD for 24 weeks (n=4 mice/group); (b, C) The protein level and relative mRNA level of USP29 in liver tissues of mice fed with NC or HFHC for 16 weeks (b) or fed with MCS or MCD for 4 weeks (C) (n=4 mice/group); (D) The protein level and relative mRNA level of USP29 in liver samples from human Normal, MASL and MASH patients (n=4 individual/group); (E) Representative immunohistochemical staining to evaluate USP29 expression in liver samples from human Normal, MASL and MASH patients (n=5 individuals/group). Scale bar, 50 μm; (F) The protein level and relative mRNA level of USP29 in mouse primary hepatocytes induced by bSA or PAOA (0.5/1.0 mM) for 12 h. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (*P<0.05, **P<0.01, n.s., not significant). NC, normal chow; HFD, high fat; HFHC, high-fat high cholesterol; MCD, methionine and choline deficient; MCS, methionine and choline sufficient; MASL, metabolic dysfunction-associated steatotic liver; MASH, metabolic dysfunction-associated steatohepatitis; PAOA, palmitic acid and oleic acid; bSA, bovine serum albumin.
cmh-2024-0478f1.jpg
Figure 2.
USP29 deletion exacerbates insulin resistance and hepatic steatosis induced by a HFD diet. (A) body weight and (b) blood glucose of WT mice and USP29-KO mice after NC chow or HFD diet treatment for indicated times (n=9–10 mice/group). (C) GTTs and (D) ITTs of WT mice and USP29-KO mice were analyzed at the week 22 and 23 fed NC chow or HFD diet, respectively (n=9–10 mice/group). (E) Liver weight and the ratio of liver weight to body weight of WT mice and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=9–10 mice/group). (F) Hepatic triglyceride (TG) content and (G) serum TG, TC and LDL-C content were detected in WT mice and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=9–10 mice/group). (H) Representative images and relative quantitative statistical analysis of H&E staining and Oil red O staining of liver tissue from WT and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD, *indicates a statistical analysis between WT-NC group and WT-HFD group (*P<0.05, **P<0.01, n.s., not significant). #indicates a statistical analysis between WT-HFD group and USP29-KO-HFD group (#P<0.05, ##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; NC, normal chow; HFD, high fat; GTT, glucose tolerance test; ITT, insulin tolerance test; TG, total triglyceride; TC, total cholesterol; LDL-C, low density lipoprotein cholesterol; H&E, hematoxylin and eosin.
cmh-2024-0478f2.jpg
Figure 3.
USP29 knockout accelerates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet. (A) blood glucose of WT and USP29-KO mice after NC or HFHC diet treatment for 16weeks (n=8–10 mice/group). (b) GTTs of WT mice and USP29-KO mice were analyzed at the week 15 fed NC chow or HFHC diet (n=8–10 mice/group). (C) The ratio of liver weight to body weight of WT mice and USP29-KO mice fed NC chow or HFD diet for 16 weeks (n=8–10 mice/group). (D) Hepatic TG content and (E) serum TG, TC and LDL-C content were detected in WT mice and USP29-KO mice fed NC or HFHC diet for 16 weeks (n=8–10 mice/group). (F) Representative images and relative quantitative statistical analysis of H&E, Oil red O staining of liver tissue from WT and USP29-KO mice fed HFHC diet for 16 weeks (n=6 mice/group). Scale bar, 50 μm. (G) Representative images and relative quantitative statistical analysis of CD11b, F4/80, PSR and a-SMA staining of liver tissue from WT and USP29-KO mice fed HFHC diet for 16 weeks (n=4–6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD, *indicates a statistical analysis between WT-NC group and WT-HFHC group (**P<0.01, n.s., not significant). #indicates a statistical analysis between WT-HFHC group and USP29-KO-HFHC group (#P<0.05, ##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; NC, normal chow; HFHC, high-fat high cholesterol; GTT, glucose tolerance test; TG, total triglyceride; TC, total cholesterol; LDL-C, low density lipoprotein cholesterol; H&E, hematoxylin and eosin; PSR, picro Sirius Red.
cmh-2024-0478f3.jpg
Figure 4.
USP29 alleviates hepatocyte lipid deposition and inflammation and promotes the fatty acid degradation pathway. (A) Representative images of Nile red staining and (b) cellular TG contents in primary hepatocytes isolated from WT and USP29-KO mice and induced by PAOA or bSA for 12 h (n=3 independent experiments). Scale bar, 25 μm. (C) Representative images of Nile red staining and (D) cellular TG content in primary hepatocytes infected with AdUSP29 and AdGFP and induced by PAOA or bSA for 12 h (n=3 independent experiments). Scale bar, 25 μm. (E) The Venn diagram shows the 16 pathways presenting with a histogram according to Robust rank aggregation down-regulated by USP29-KO but up-regulated by USP29-overexpressing hepatocytes under PAOA treatment, and then the GSEA show the pathway of fatty acid degradation regulated by USP29-KO and USP29 overexpression. (F) The Venn diagram shows the 12 pathways presenting with a histogram according to Robust rank aggregation up-regulated by USP29-KO but down-regulated by USP29-overexpressing hepatocytes under PAOA treatment, and then the GSEA show the pathway of cytokine - cytokine receptor interaction regulated by USP29-KO and USP29 overexpression. The data are presented as mean±SD (**P<0.01, n.s., not significant). bSA, bovine serum albumin; PAOA, palmitate acid and oleic acid; WT, wild type; KO, USP29 knock out; OE, over-expression; TG, total triglyceride.
cmh-2024-0478f4.jpg
Figure 5.
USP29 interacts with ACSL5 and upregulates the ACSL5 expression. (A) Flow diagram of IP-MS in AdUSP29 and AdGFP group. (b) Endogenous IP assays were performed to evaluate the interaction between USP29 and ACSL5, ALDH2, ACOX1 in AdUSP29 hepatocytes treated with PAOA. (C) The protein level of ACSL5, ALDH2 and ACOX1 in AdUSP29 hepatocytes induced by PAOA. (D–F) Western blotting analysis to assay ACSL5 protein level in indicated mouse primary hepatocytes under PAOA treatment and liver tissue of WT and USP29-KO mice fed for 16 weeks with HFHC (n=3 mice/group). (G, H) The protein level and representative immunohistochemical image of ACSL5 and in liver samples from normal, MASL and MASH patients (n=3–4 individuals/group). (I) The protein level of ACSL5 in primary hepatocytes induced with bSA or PAOA. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (**P<0.01, n.s., not significant). bSA, bovine serum albumin; PAOA, palmitate acid and oleic acid; WT, wild type; KO, USP29 knock out; HFHC, high-fat high cholesterol; MASL, metabolic dysfunction-associated steatotic liver; MASH, metabolic dysfunction-associated steatohepatitis.
cmh-2024-0478f5.jpg
Figure 6.
The effect of USP29 on hepatocyte lipid accumulation and MASLD is dependent on ACSL5. (A) The protein expression of USP29 and ACSL5 in WT or USP29-KO primary hepatocytes infected with ACSL5 overexpression and control adenovirus after PAOA stimulation. (b) Representative images of Nile red staining and (C) cellular TG content in indicated primary hepatocytes induced by PAOA (n=3 independent experiments). Scale bar, 25 μm. (D) The mRNA levels of Cpt1a, Ehhadh, Cxcl2 and Ccl5 in indicated primary hepatocytes induced by PAOA (n=4 mice/group). (E) The liver weight and the ratio of liver weight to body weight in USP29-KO and WT mice injected with AAV8-ACSL5 and controls fed a HFHC diet for 16 weeks (n=9 mice/group). (F) The serum lipid contents including TG and TC were detected in USP29-KO and WT mice injected with AAV8-ACSL5 and controls fed HFHC diet for 16 weeks (n=9 mice/group). (G) Representative images and relative quantitative statistical analysis of H&E, Oil red O, CD11b and PSR staining in liver tissue from USP29-KO and WT mice injected with AAV8-ACSL5 and controls fed HFHC diet for 16 weeks (n=4–6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD (*P<0.05, **P<0.01, n.s., not significant). WT, wild type; KO, knock out; AAV, adeno-associated virus; HFHC, high-fat high cholesterol; TG, total triglyceride; TC, total cholesterol; H&E, hematoxylin and eosin; PSR, picro Sirius Red.
cmh-2024-0478f6.jpg
Figure 7.
USP29 directly interacts with ACSL5. (A, b) Co-IP analysis of interaction between USP29 and ACSL5 in HEK293T cells cotransfected Flag-USP29 and HA-ACSL5. (C, D) GST pull down assays showing direct binding of USP29 and ACSL5. Purified GST was used as a control. (E, F) The interaction between USP29 and ACSL5 domains was investigated by IP analysis through transfection of HEK293T cells with both USP29 or ACSL5 full-length and truncated expression plasmids. IP, immunoprecipitation.
cmh-2024-0478f7.jpg
Figure 8.
USP29 stabilizes ACSL5 through the suppression of K48-linked ubiquitination. (A) The protein expression of ACSL5 in primary hepatocytes treated with PAOA and protein synthesis inhibitor cycloheximide (CHX; 25 µg/mL). (b, C) Ubiquitination assays determining the ubiquitination of endogenous ACSL5 in AdUSP29 primary hepatocytes (b) and USP29-KO primary hepatocytes (C) with PAOA treatment. (D) Ubiquitination assays screening the potential lysine ubiquitin type of HA-ACSL5 in response to USP29 overexpression in HEK293T cells transfected with wild type (WT) or different mutant Myc-Ub plasmid. (E) Ubiquitination assays determining the k48 linked ubiquitination of endogenous ACSL5 in primary hepatocytes from WT and USP29-KO mice after PAOA treatment. (F) Ubiquitination assays determining the k48 linked ubiquitination of endogenous ACSL5 in primary hepatocytes infected with adenovirus AdUSP29 and AdUSP29-mutant (AdUSP29-m) under PAOA treatment. (G) The protein expression of ACSL5 in primary hepatocytes infected with adenovirus AdUSP29 and AdUSP29-mutant (AdUSP29-m) under PAOA treatment. (H) Representative images of Nile red staining and (I) cellular TG content in indicated primary hepatocytes induced by PAOA for 12 h (n=3 independent experiments). Scale bar, 25 μm. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (**P<0.01, n.s., not significant). PAOA, palmitate acid and oleic acid; CHX, cycloheximide; IP, immunoprecipitation; WT, wild type; KO, USP29 knock out; TG, total triglyceride.
cmh-2024-0478f8.jpg
cmh-2024-0478f9.jpg

ALT

alanine aminotransferase

AST

aspartate aminotransferase

HCC

hepatocellular carcinoma

HFD

high-fat diet

HFHC

high-fat high-cholesterol

MASL

metabolic dysfunction-associated steatotic liver

MASH

metabolic dysfunction-associated steatohepatitis

MASLD

metabolic dysfunction–associated steatotic liver disease

MCD

methionine and choline deficient

NAFLD

nonalcoholic fatty liver disease

NC

normal chow

PAOA

palmitic acid and oleic acid

TC

total cholesterol

TG

triglyceride

USP29

ubiquitin-specific protease 29

USP29-KO

USP29 knockout

WT

wild-type
  • 1. Younossi Z, Anstee QM, Marietti M, Hardy T, Henry L, Eslam M, et ak. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat Rev Gastroenterol Hepatol 2018;15:11-20.
  • 2. Powell EE, Wong VW, Rinella M. Non-alcoholic fatty liver disease. Lancet 2021;397:2212-2224.
  • 3. European Association for the Study of the Liver; European Association for the Study of Diabetes; European Association for the Study of Obesity. EASL-EASD-EASO clinical practice guidelines on the management of metabolic dysfunction-associated steatotic liver disease (MASLD): executive summary. Diabetologia 2024;67:2375-2392.
  • 4. Riazi K, Azhari H, Charette JH, Underwood FE, King JA, Afshar EE, et al. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol 2022;7:851-861.
  • 5. Yong JN, Lim WH, Ng CH, Tan DJH, Xiao J, Tay PWL, et al. Outcomes of nonalcoholic steatohepatitis after liver transplantation: an updated meta-analysis and systematic review. Clin Gastroenterol Hepatol 2023;21:45-54.e6.
  • 6. Wang Z, Ye M, Zhang XJ, Zhang P, Cai J, Li H, et al. Impact of NAFLD and its pharmacotherapy on lipid profile and CVD. Atherosclerosis 2022;355:30-44.
  • 7. Chen Z, Liu J, Zhou F, Li H, Zhang XJ, She ZG, et al. Nonalcoholic fatty liver disease: an emerging driver of cardiac arrhythmia. Circ Res 2021;128:1747-1765.
  • 8. Zhao YC, Zhao GJ, Chen Z, She ZG, Cai J, Li H. Nonalcoholic fatty liver disease: an emerging driver of hypertension. Hypertension 2020;75:275-284.
  • 9. Harrison SA, Loomba R, Dubourg J, Ratziu V, Noureddin M. Clinical trial landscape in NASH. Clin Gastroenterol Hepatol 2023;21:2001-2014.
  • 10. Harrison SA, Bedossa P, Guy CD, Schattenberg JM, Loomba R, Taub R, et al. A phase 3, randomized, controlled trial of resmetirom in NASH with liver fibrosis. N Engl J Med 2024;390:497-509.
  • 11. Harrison SA, Taub R, Neff GW, Lucas KJ, Labriola D, Moussa SE, et al. Resmetirom for nonalcoholic fatty liver disease: a randomized, double-blind, placebo-controlled phase 3 trial. Nat Med 2023;29:2919-2928.
  • 12. B arbier-Torres L, Fortner KA, Iruzubieta P, Delgado TC, Giddings E, Chen Y, et al. Silencing hepatic MCJ attenuates nonalcoholic fatty liver disease (NAFLD) by increasing mitochondrial fatty acid oxidation. Nat Commun 2020;11:3360.
  • 13. Ipsen DH, Lykkesfeldt J, Tveden-Nyborg P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol Life Sci 2018;75:3313-3327.
  • 14. Marra F, Svegliati-Baroni G. Lipotoxicity and the gut-liver axis in NASH pathogenesis. J Hepatol 2018;68:280-295.
  • 15. Houten SM, Violante S, Ventura FV, Wanders RJ. The biochemistry and physiology of mitochondrial fatty acid β-oxidation and its genetic disorders. Annu Rev Physiol 2016;78:23-44.
  • 16. Xu T, Lim YT, Chen L, Zhao H, Low JH, Xia Y, et al. A novel mechanism of monoethylhexyl phthalate in lipid accumulation via inhibiting fatty acid beta-oxidation on hepatic cells. Environ Sci Technol 2020;54:15925-15934.
  • 17. Hou T, Tian Y, Cao Z, Zhang J, Feng T, Tao W, et al. Cytoplasmic SIRT6-mediated ACSL5 deacetylation impedes nonalcoholic fatty liver disease by facilitating hepatic fatty acid oxidation. Mol Cell 2022;82:4099-4115.e9.
  • 18. Ren J, Yu P, Liu S, Li R, Niu X, Chen Y, et al. Deubiquitylating enzymes in cancer and immunity. Adv Sci (Weinh) 2023;10:e2303807.
  • 19. Kim J, Noskov VN, Lu X, Bergmann A, Ren X, Warth T, et al. Discovery of a novel, paternally expressed ubiquitin-specific processing protease gene through comparative analysis of an imprinted region of mouse chromosome 7 and human chromosome 19q13.4. Genome Res 2000;10:1138-1147.
  • 20. Zhang R, Cai Z, Ren D, Kang Y, Zhang Q, Lu X, et al. The emerging role of USP29 in cancer and other diseases. Cell Biochem Funct 2024;42:e3928.
  • 21. Chen Z, Hu F, Zhang Y, Zhang L, Wang T, Kong C, et al. Ubiquitin-specific protease 29 attenuates hepatic ischemia-reperfusion injury by mediating TGF-β-activated kinase 1 deubiquitination. Front Immunol 2023;14:1167667.
  • 22. Gao R, Buechel D, Kalathur RKR, Morini MF, Coto-Llerena M, Ercan C, et al. USP29-mediated HIF1α stabilization is associated with Sorafenib resistance of hepatocellular carcinoma cells by upregulating glycolysis. Oncogenesis 2021;10:52.
  • 23. Sheka AC, Adeyi O, Thompson J, Hameed B, Crawford PA, Ikramuddin S. Nonalcoholic steatohepatitis: a review. JAMA 2020;323:1175-1183.
  • 24. Gissen P, Arias IM. Structural and functional hepatocyte polarity and liver disease. J Hepatol 2015;63:1023-1037.
  • 25. Hou Z, Shi W, Feng J, Wang W, Zheng E, Lin H, et al. Self-stabilizing regulation of deubiquitinating enzymes in an enzymatic activity-dependent manner. Int J Biol Macromol 2021;181:1081-1091.
  • 26. Moore MP, Cunningham RP, Meers GM, Johnson SA, Wheeler AA, Ganga RR, et al. Compromised hepatic mitochondrial fatty acid oxidation and reduced markers of mitochondrial turnover in human NAFLD. Hepatology 2022;76:1452-1465.
  • 27. Rinaldo P, Matern D, Bennett MJ. Fatty acid oxidation disorders. Annu Rev Physiol 2002;64:477-502.
  • 28. Jump DB, Tripathy S, Depner CM. Fatty acid-regulated transcription factors in the liver. Annu Rev Nutr 2013;33:249-269.
  • 29. Zeng S, Wu F, Chen M, Li Y, You M, Zhang Y, et al. Inhibition of fatty acid translocase (FAT/CD36) palmitoylation enhances hepatic fatty acid β-oxidation by increasing its localization to mitochondria and interaction with long-chain acyl-CoA synthetase 1. Antioxid Redox Signal 2022;36:1081-1100.
  • 30. Kwak HB, Woodlief TL, Green TD, Cox JH, Hickner RC, Neufer PD, et al. Overexpression of long-chain acyl-CoA synthetase 5 increases fatty acid oxidation and free radical formation while attenuating insulin signaling in primary human skeletal myotubes. Int J Environ Res Public Health 2019;16:1157.
  • 31. Luo Q, Das A, Oldoni F, Wu P, Wang J, Luo F, et al. Role of ACSL5 in fatty acid metabolism. Heliyon 2023;9:e13316.
  • 32. Schoonjans K, Staels B, Auwerx J. Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J Lipid Res 1996;37:907-925.
  • 33. Hihi AK, Michalik L, Wahli W. PPARs: transcriptional effectors of fatty acids and their derivatives. Cell Mol Life Sci 2002;59:790-798.
  • 34. Chen L, Vasoya RP, Toke NH, Parthasarathy A, Luo S, Chiles E, et al. HNF4 regulates fatty acid oxidation and is required for renewal of intestinal stem cells in mice. Gastroenterology 2020;158:985-999.e9.
  • 35. Achouri Y, Hegarty BD, Allanic D, Bécard D, Hainault I, Ferré P, et al. Long chain fatty acyl-CoA synthetase 5 expression is induced by insulin and glucose: involvement of sterol regulatory element-binding protein-1c. Biochimie 2005;87:1149-1155.
  • 36. Gao H, Yin J, Ji C, Yu X, Xue J, Guan X, et al. Targeting ubiquitin specific proteases (USPs) in cancer immunotherapy: from basic research to preclinical application. J Exp Clin Cancer Res 2023;42:225.
  • 37. Kitamura H. Ubiquitin-specific proteases (USPs) and metabolic disorders. Int J Mol Sci 2023;24:3219.
  • 38. Jo A, Lee Y, Park CH, Shin JH. Deubiquitinase USP29 governs MYBB P1A in the brains of Parkinson’s disease patients. J Clin Med 2019;9:52.
  • 39. Qian W, Li Q, Wu X, Li W, Li Q, Zhang J, et al. Deubiquitinase USP29 promotes gastric cancer cell migration by cooperating with phosphatase SCP1 to stabilize snail protein. Oncogene 2020;39:6802-6815.
  • 40. Zhang Q, Tang Z, An R, Ye L, Zhong B. USP29 maintains the stability of cGAS and promotes cellular antiviral responses and autoimmunity. Cell Res 2020;30:914-927.
  • 41. Manne V, Handa P, Kowdley KV. Pathophysiology of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. Clin Liver Dis 2018;22:23-37.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

USP29 alleviates the progression of MASLD by stabilizing ACSL5 through K48 deubiquitination
Clin Mol Hepatol. 2025;31(1):147-165.   Published online October 2, 2024
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
USP29 alleviates the progression of MASLD by stabilizing ACSL5 through K48 deubiquitination
Clin Mol Hepatol. 2025;31(1):147-165.   Published online October 2, 2024
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • 7
  • 8
USP29 alleviates the progression of MASLD by stabilizing ACSL5 through K48 deubiquitination
Image Image Image Image Image Image Image Image Image
Figure 1. USP29 expression is down-regulated in the pathogenesis of MASLD. (A) The protein level and relative mRNA level of USP29 in liver tissues of mice fed with NC or HFD for 24 weeks (n=4 mice/group); (b, C) The protein level and relative mRNA level of USP29 in liver tissues of mice fed with NC or HFHC for 16 weeks (b) or fed with MCS or MCD for 4 weeks (C) (n=4 mice/group); (D) The protein level and relative mRNA level of USP29 in liver samples from human Normal, MASL and MASH patients (n=4 individual/group); (E) Representative immunohistochemical staining to evaluate USP29 expression in liver samples from human Normal, MASL and MASH patients (n=5 individuals/group). Scale bar, 50 μm; (F) The protein level and relative mRNA level of USP29 in mouse primary hepatocytes induced by bSA or PAOA (0.5/1.0 mM) for 12 h. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (*P<0.05, **P<0.01, n.s., not significant). NC, normal chow; HFD, high fat; HFHC, high-fat high cholesterol; MCD, methionine and choline deficient; MCS, methionine and choline sufficient; MASL, metabolic dysfunction-associated steatotic liver; MASH, metabolic dysfunction-associated steatohepatitis; PAOA, palmitic acid and oleic acid; bSA, bovine serum albumin.
Figure 2. USP29 deletion exacerbates insulin resistance and hepatic steatosis induced by a HFD diet. (A) body weight and (b) blood glucose of WT mice and USP29-KO mice after NC chow or HFD diet treatment for indicated times (n=9–10 mice/group). (C) GTTs and (D) ITTs of WT mice and USP29-KO mice were analyzed at the week 22 and 23 fed NC chow or HFD diet, respectively (n=9–10 mice/group). (E) Liver weight and the ratio of liver weight to body weight of WT mice and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=9–10 mice/group). (F) Hepatic triglyceride (TG) content and (G) serum TG, TC and LDL-C content were detected in WT mice and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=9–10 mice/group). (H) Representative images and relative quantitative statistical analysis of H&E staining and Oil red O staining of liver tissue from WT and USP29-KO mice fed NC chow or HFD diet for 24 weeks (n=6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD, *indicates a statistical analysis between WT-NC group and WT-HFD group (*P<0.05, **P<0.01, n.s., not significant). #indicates a statistical analysis between WT-HFD group and USP29-KO-HFD group (#P<0.05, ##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; NC, normal chow; HFD, high fat; GTT, glucose tolerance test; ITT, insulin tolerance test; TG, total triglyceride; TC, total cholesterol; LDL-C, low density lipoprotein cholesterol; H&E, hematoxylin and eosin.
Figure 3. USP29 knockout accelerates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet. (A) blood glucose of WT and USP29-KO mice after NC or HFHC diet treatment for 16weeks (n=8–10 mice/group). (b) GTTs of WT mice and USP29-KO mice were analyzed at the week 15 fed NC chow or HFHC diet (n=8–10 mice/group). (C) The ratio of liver weight to body weight of WT mice and USP29-KO mice fed NC chow or HFD diet for 16 weeks (n=8–10 mice/group). (D) Hepatic TG content and (E) serum TG, TC and LDL-C content were detected in WT mice and USP29-KO mice fed NC or HFHC diet for 16 weeks (n=8–10 mice/group). (F) Representative images and relative quantitative statistical analysis of H&E, Oil red O staining of liver tissue from WT and USP29-KO mice fed HFHC diet for 16 weeks (n=6 mice/group). Scale bar, 50 μm. (G) Representative images and relative quantitative statistical analysis of CD11b, F4/80, PSR and a-SMA staining of liver tissue from WT and USP29-KO mice fed HFHC diet for 16 weeks (n=4–6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD, *indicates a statistical analysis between WT-NC group and WT-HFHC group (**P<0.01, n.s., not significant). #indicates a statistical analysis between WT-HFHC group and USP29-KO-HFHC group (#P<0.05, ##P<0.01, n.s., not significant). WT, wild type; KO, USP29 knockout; NC, normal chow; HFHC, high-fat high cholesterol; GTT, glucose tolerance test; TG, total triglyceride; TC, total cholesterol; LDL-C, low density lipoprotein cholesterol; H&E, hematoxylin and eosin; PSR, picro Sirius Red.
Figure 4. USP29 alleviates hepatocyte lipid deposition and inflammation and promotes the fatty acid degradation pathway. (A) Representative images of Nile red staining and (b) cellular TG contents in primary hepatocytes isolated from WT and USP29-KO mice and induced by PAOA or bSA for 12 h (n=3 independent experiments). Scale bar, 25 μm. (C) Representative images of Nile red staining and (D) cellular TG content in primary hepatocytes infected with AdUSP29 and AdGFP and induced by PAOA or bSA for 12 h (n=3 independent experiments). Scale bar, 25 μm. (E) The Venn diagram shows the 16 pathways presenting with a histogram according to Robust rank aggregation down-regulated by USP29-KO but up-regulated by USP29-overexpressing hepatocytes under PAOA treatment, and then the GSEA show the pathway of fatty acid degradation regulated by USP29-KO and USP29 overexpression. (F) The Venn diagram shows the 12 pathways presenting with a histogram according to Robust rank aggregation up-regulated by USP29-KO but down-regulated by USP29-overexpressing hepatocytes under PAOA treatment, and then the GSEA show the pathway of cytokine - cytokine receptor interaction regulated by USP29-KO and USP29 overexpression. The data are presented as mean±SD (**P<0.01, n.s., not significant). bSA, bovine serum albumin; PAOA, palmitate acid and oleic acid; WT, wild type; KO, USP29 knock out; OE, over-expression; TG, total triglyceride.
Figure 5. USP29 interacts with ACSL5 and upregulates the ACSL5 expression. (A) Flow diagram of IP-MS in AdUSP29 and AdGFP group. (b) Endogenous IP assays were performed to evaluate the interaction between USP29 and ACSL5, ALDH2, ACOX1 in AdUSP29 hepatocytes treated with PAOA. (C) The protein level of ACSL5, ALDH2 and ACOX1 in AdUSP29 hepatocytes induced by PAOA. (D–F) Western blotting analysis to assay ACSL5 protein level in indicated mouse primary hepatocytes under PAOA treatment and liver tissue of WT and USP29-KO mice fed for 16 weeks with HFHC (n=3 mice/group). (G, H) The protein level and representative immunohistochemical image of ACSL5 and in liver samples from normal, MASL and MASH patients (n=3–4 individuals/group). (I) The protein level of ACSL5 in primary hepatocytes induced with bSA or PAOA. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (**P<0.01, n.s., not significant). bSA, bovine serum albumin; PAOA, palmitate acid and oleic acid; WT, wild type; KO, USP29 knock out; HFHC, high-fat high cholesterol; MASL, metabolic dysfunction-associated steatotic liver; MASH, metabolic dysfunction-associated steatohepatitis.
Figure 6. The effect of USP29 on hepatocyte lipid accumulation and MASLD is dependent on ACSL5. (A) The protein expression of USP29 and ACSL5 in WT or USP29-KO primary hepatocytes infected with ACSL5 overexpression and control adenovirus after PAOA stimulation. (b) Representative images of Nile red staining and (C) cellular TG content in indicated primary hepatocytes induced by PAOA (n=3 independent experiments). Scale bar, 25 μm. (D) The mRNA levels of Cpt1a, Ehhadh, Cxcl2 and Ccl5 in indicated primary hepatocytes induced by PAOA (n=4 mice/group). (E) The liver weight and the ratio of liver weight to body weight in USP29-KO and WT mice injected with AAV8-ACSL5 and controls fed a HFHC diet for 16 weeks (n=9 mice/group). (F) The serum lipid contents including TG and TC were detected in USP29-KO and WT mice injected with AAV8-ACSL5 and controls fed HFHC diet for 16 weeks (n=9 mice/group). (G) Representative images and relative quantitative statistical analysis of H&E, Oil red O, CD11b and PSR staining in liver tissue from USP29-KO and WT mice injected with AAV8-ACSL5 and controls fed HFHC diet for 16 weeks (n=4–6 mice/group). Scale bar, 50 μm. The data are presented as mean±SD (*P<0.05, **P<0.01, n.s., not significant). WT, wild type; KO, knock out; AAV, adeno-associated virus; HFHC, high-fat high cholesterol; TG, total triglyceride; TC, total cholesterol; H&E, hematoxylin and eosin; PSR, picro Sirius Red.
Figure 7. USP29 directly interacts with ACSL5. (A, b) Co-IP analysis of interaction between USP29 and ACSL5 in HEK293T cells cotransfected Flag-USP29 and HA-ACSL5. (C, D) GST pull down assays showing direct binding of USP29 and ACSL5. Purified GST was used as a control. (E, F) The interaction between USP29 and ACSL5 domains was investigated by IP analysis through transfection of HEK293T cells with both USP29 or ACSL5 full-length and truncated expression plasmids. IP, immunoprecipitation.
Figure 8. USP29 stabilizes ACSL5 through the suppression of K48-linked ubiquitination. (A) The protein expression of ACSL5 in primary hepatocytes treated with PAOA and protein synthesis inhibitor cycloheximide (CHX; 25 µg/mL). (b, C) Ubiquitination assays determining the ubiquitination of endogenous ACSL5 in AdUSP29 primary hepatocytes (b) and USP29-KO primary hepatocytes (C) with PAOA treatment. (D) Ubiquitination assays screening the potential lysine ubiquitin type of HA-ACSL5 in response to USP29 overexpression in HEK293T cells transfected with wild type (WT) or different mutant Myc-Ub plasmid. (E) Ubiquitination assays determining the k48 linked ubiquitination of endogenous ACSL5 in primary hepatocytes from WT and USP29-KO mice after PAOA treatment. (F) Ubiquitination assays determining the k48 linked ubiquitination of endogenous ACSL5 in primary hepatocytes infected with adenovirus AdUSP29 and AdUSP29-mutant (AdUSP29-m) under PAOA treatment. (G) The protein expression of ACSL5 in primary hepatocytes infected with adenovirus AdUSP29 and AdUSP29-mutant (AdUSP29-m) under PAOA treatment. (H) Representative images of Nile red staining and (I) cellular TG content in indicated primary hepatocytes induced by PAOA for 12 h (n=3 independent experiments). Scale bar, 25 μm. The protein expression and mRNA expression were normalized to β-actin levels. The data are presented as mean±SD (**P<0.01, n.s., not significant). PAOA, palmitate acid and oleic acid; CHX, cycloheximide; IP, immunoprecipitation; WT, wild type; KO, USP29 knock out; TG, total triglyceride.
Graphical abstract
USP29 alleviates the progression of MASLD by stabilizing ACSL5 through K48 deubiquitination